Gene putatively regulated by attenuation in B_cereus_ATCC14579_pl-pBClin15

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:18 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -4.81 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-10.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACTCGTGTTTAACCAAGCTGACACGCCTTACAATATCGACCCGTTAGCGTTGAC
ACATTTAAATCATATGCAACTCGGTTACCCACTCCCAAAAGGAATGTATGTCTTTGAC
TTCAGTAACCAAGGTATTACAAATCTAGGTGGTAGCCGTGACTATATTGATACAGAAC
GTCTAACAGAATTCTGGGTACGTTTCGGGTCACAAAAACCGGGTCGTATTACGGTAGT
TTCTGAAACATTATCAAGATTACGATAAggggctttgctcctttcgttttctataaggaggaaaacaaATG

    BCp0011 --- BCp0012


Gene: BCp0011     GI: 29899122     BI number: BCp0011     GOG: -------     Description: hypothetical membrane spanning protein
Gene: BCp0012     GI: 29899123     BI number: BCp0012     GOG: -------     Description: hypothetical protei


 GT
C  A
T  T
G  T       AT
G  A      G  T
 GC       A  A
 CG       A  C
 CG        CG
 AT        TA
A  A       AT
A  |       TA
A  |      T  |
A  |      A  |        t
 CG       C  |      t  t
 AT       A  |       cg
C  T      A  |       gc
T  |      A  |       gt
 GT       G  |       gc
 GC        TA        gc
 GT        Cg        At
 CG       T  g       At
 TA       T  g      T  |
 TA        Tg        At
 TA        Gc        Gc
 GC        At        Cg
                        ttttctataaggaggaaaacaaATG


    ..................................................................................................................