                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.40 kcal/mol
Antiterminator: Size=52 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAAAAGTAGATGGGGAAGAGTTAAAAATCTCTTTTAGTGCAAAATATATGATGGA
TGCACTAAAAGCATTAGATAGTACTGAAATTAAGATTAGCTTTACTGGAGCAATGAGA
CCATTCTTAATTCGTACAGTAAATGATGAATCCATTATTCAATTAATTTTACCGGTTC
GTACTTACTAAgtaagaaataagggttgctagttttcagatgctagtagcccttatttgatttttgggtattactttcctaatgctagttta
tttagtacaatgaaagaatgaacactttcagaaaGTG

    BCE0003 --- recF --- gyrB Gene: BCE0003     GI: 42779084     BI number: BCE0003     GOG: COG2501     Description: conserved hypothetical protein Gene: recF     GI: 42779085     BI number: BCE0004     GOG: COG1195     Description: DNA replication and repair protein RecF Gene: gyrB     GI: 42779086     BI number: BCE0005     GOG: COG0187     Description: DNA gyrase, B subuni             C           A  T   T        TA A  T       TA A  A       Cg C  A       At T  T       Ta T  T      G  a A  T       Cg T  T       Ta T  A       Ta A  C      |  a C  C      |  t CG       G  a       ca TG       G  a      t  g AT        Cg       t  a AT        Cg       t  t GC       A  g       tg TG       T  t       gc AT       T  t       at G  A      T  g       ta T  C      T  c       cg A  |      A  |       gt AT        At        ta AT        Ta        tg TA        Tg        gc GC        At        gc AT        At        gc                         ttatttgatttttgggtattactttcctaatgctagtttatttagtacaatgaaagaatgaacactttcagaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2501 Uncharacterized conserved protein ... can be seen here [L] COG1195 Recombinational DNA repair ATPase (RecF pathway) ... can be seen here [L] COG0187 Type IIA topoisomerase (DNA gyrase/topo II, topoisomerase IV), B subunit ... can be seen here     ..................................................................................................................