                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:82 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-17.80 kcal/mol

                                                                        Nomenclature/Definitions

AAAGAAAAACAAAAAACTCAAAAACGTAAAGAAGTGAAGCCGAAGACAGATATTGGTG
AAGGCTACGATAATTTAGCAAGACTATATCAAGAAGGTTTTCATATTTGTAATCTGCA
TTATGGAAGTGTACGTAAAGAGGGAGATTGTTTATTCTGCCTGTCATTTTTAAATAAA
AAGTGAaattacctttccaataataattggaaaggtaattttttatacatgagagtagaatcgaatatgttttttattagtagaagatgaaatagg
gtaggttaagtgtaagaaaaggagcaacatATG

    BCE0030 --- BCE0031 --- BCE0032 Gene: BCE0032     GI: 42779113     BI number: BCE0032     GOG: COG4123     Description: conserved hypothetical protein Gene: BCE0033     GI: 42779114     BI number: BCE0033     GOG: COG2827     Description: conserved hypothetical protein Gene: BCE0034     GI: 42779115     BI number: BCE0034     GOG: COG0313     Description: conserved hypothetical protein TIGR0009           at          a  a           ta           at           at           cg           cg           ta           ta           ta           cg           cg           at           ta           ta           at           at             ttttatacatgagagtagaatcgaatatgttttttattagtagaagatgaaatagggtaggttaagtgtaagaaaaggagcaacatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4123 Predicted O-methyltransferase ... can be seen here [L] COG2827 Predicted endonuclease containing a URI domain ... can be seen here [R] COG0313 Predicted methyltransferases ... can be seen here     ..................................................................................................................