                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=56 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTTAAGGCTAATGTTGTTGGTATTGGTGTATTAGTAGAATCCACGGATATTGAAGAA
AGACTAATTAATAACTATGTATCATTGATTCGTCTATCGGAAGTTGATGTGAAAGAAA
AAGCGATTCAAGTGGAAAAGGGAAATTATTCACTGGCACCATTTGATGAAGGGCTTGT
AGAGGCTGAGTAAaaaggtaaagcaaatagctttatctttttttattctatttataagttacaaaatagatggacaaactgcttttcgtgc
actatttttaaagagtaaaaataaataataaaaggGTG

    BCE0045 Gene: BCE0045     GI: 42779126     BI number: BCE0045     GOG: COG0251     Description: endoribonuclease L-PSP, putativ TT A  A AT AT GC |  A GC GT A  G A  G       TA A  C      G  G A  A       TA GC        TG GC        CG TA        GC GT        GT         a AT       G  G      a  t AT       A  A      a  a CG       A  |       cg TA       G  |       gc |  T       TG        at |  G       AT        at |  A      G  A       at T  A       TA        ta A  G       Ta        gt G  G       Ta        gc CG       A  a       at GC        Cg        at AT        Cg        at AT        At        At                         tttattctatttataagttacaaaatagatggacaaactgcttttcgtgcactatttttaaagagtaaaaataaataataaaaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0251 Putative translation initiation inhibitor, yjgF family ... can be seen here     ..................................................................................................................