                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:197 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.40 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-10.30 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-12.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTATTGCAAATGTCTGGATTAGTGATGGATACAAGTCATAGAGGTGTTGCAACACTTG
AGGCGTTGTTAGGTGTAGCCATCGGCGGATTGGCATATATGTTTTTCATTTTAAAATT
ACGTGTATTTACAAAAGCGGAAATAGGAACCGTTATGAAAAAAGAGAAAAAAGAAGGT
TCATTGAAGAAGAGTGGATAGaggtggcaggttgtgagtggaatcattactattttaggattaggtgctggtgaattagatcagt
taacgatgggtgtatatcgaaaaataaaagaagcagatcacATG

    BCE0054 --- BCE0055 Gene: BCE0054     GI: 42779135     BI number: BCE0054     GOG: COG1694,COG3956     Description: tetrapyrrole methylase family protein/MazG family protein Gene: BCE0055     GI: 42779136     BI number: BCE0055     GOG: COG1188     Description: S4 domain protei   G T  G A  A GT TA GC         G A  A      C  T TA       G  T TG       G  G AT        AT GC        GT |  A       TA        GC GT        TG       G  G TA        CG        CG CG        AT        TA TA        CG       |  T G  G       AT        AT TG       A  A       CG AT        CG        CG |  G       GC        GC AT       T  |      |  A AT       T  |       AT CG        GC        TA GC        TA        GT TA        GT        TA TA        GC        GT                         GTTTTTCATTTTAAAATTACGTGTATTTACAAAAGCGGAAATAGGAACCGTTATGAAAAAAGAGAAAAAAGAAGGTTCATTGAAGAAGAGTGGATAGaggtggcaggttgtgagtggaatcattactattttaggattaggtgctggtgaattagatcagttaacgatgggtgtatatcgaaaaataaaagaagcagatcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1694 Predicted pyrophosphatase ... can be seen here [R] COG3956 Protein containing tetrapyrrole methyltransferase domain and MazG-like (predicted pyrophosphatase) domain ... can be seen here [J] COG1188 Ribosome-associated heat shock protein implicated in the recycling of the 50S subunit (S4 paralog) ... can be seen here     ..................................................................................................................