                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:101 nt.     Distance to run of Ts=2 nt.   Size=21 nt.     Delta G= -8.30 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTGTAACGTTTTATCAACAAAACAGTTCCATTAAAGCAAAAGAAGCAAAAGTTAAGG
ACATGAAAAAAGAACTGGATTCATTAACGAACAAAGAAAAGAGTCTAAAAGACGAAGT
TCAAAAGTTAAATGATGAAGAGTACGTATTAAAGATTGCTAGAAGGGATTATTTCTTC
TCTGGAAAAGGGGAGATAATTTTTCCTGTTTCTAAGTAGagtatgtcttattgacactatattttaggatt
atatataataaagtaaaatttgactttttaaccactaaggaggagcattttttttATG

    BCE0059 Gene: BCE0059     GI: 42779140     BI number: BCE0059     GOG: COG1098     Description: S1 RNA binding domain protei   A T  T T  T        A AT       G  A GC       G  A GT        TA G  T       CG A  C       TG AT        CG GC        TG AT        TA TG        CG CG        TA             TAATTTTTCCTGTTTCTAAGTAGagtatgtcttattgacactatattttaggattatatataataaagtaaaatttgactttttaaccactaaggaggagcattttttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG1098 Predicted RNA binding protein (contains ribosomal protein S1 domain) ... can be seen here     ..................................................................................................................