Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.20 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=28 nt.     Delta G= -3.59 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTTGAAGCACAATTAAAAGAACGCGAACAAGGTAATGATGAAGCTCACATGATGGAT
GATGATTATATTGAAGCTCTTGAGTATGGTATGCCTCCTACAGGTGGACTAGGAATTG
GTATTGATCGTCTTGTTATGTTATTAACGAATGCACCATCTATTCGTGACGTACTATT
ATTCCCTGCTATGCGTCATAAACAAGACTAAgctttggagatttctccaaagctttttttatttgagtatgaacgtg
gggcattagatgtcgatgttgggagaaattatatttatatagaagaaaaGTG

    BCE0074 --- lysS


Gene: BCE0076     GI: 42779157     BI number: BCE0076     GOG: -------     Description: hypothetical protein
Gene: BCE0077     GI: 42779158     BI number: BCE0077     GOG: -------     Description: hypothetical protei


           AA
          A  C
          T  A
          A  A
           CG
           TA
           GC
 TC       C  |
T  C       GT        tt
A  C       TA       a  t
T  T      A  |       gc
T  G       TA        at
A  C       Cg        gc
T  T       Gc        gc
C  A      |  t       ta
 AT       T  t       ta
 TG       C  t       ta
 GC        Cg        cg
 CG        Cg        gc
 AT        Ta        At
 GC        Tg        At
                        tttttatttgagtatgaacgtggggcattagatgtcgatgttgggagaaattatatttatatagaagaaaaGTG
    ..................................................................................................................