Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:89 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -5.63 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAGCGATTTAGAAAGAAAAGTGCTTTCTTTATATCTAGACGGCCGTTCTTATCAAGA
GATTTCGGAACAGTTAAATAGACATGTGAAATCTATTGATAACGCTTTACAGAGGGTG
AAGCGGAAATTGGAACGATATATGGAAATGCGAGAGAGTACTACTTTAAATTCATAAc
aagtactacaggtgtaaaaatcacctgttttctttttgtagggagtacaaaaggcatgacattgacattgtcttttattgtatgatacatttttagggac
ataatgttacaaggttggtgtaactaATG

    BCE0092 --- sigH


Gene: rpmG     GI: 42779175     BI number: BCE0094     GOG: -------     Description: ribosomal protein L33
Gene: BCE0095     GI: 42779176     BI number: BCE0095     GOG: -------     Description: preprotein translocase, SecE subuni


  T
A  T
A  C
A  A
T  T
T  A
T  A
C  c        a
A  a      a  a
 Ta       a  a
 Cg       t  t
 At        gc
 Ta        ta
 Gc        gc
 At        gc
|  a       at
G  c       cg
A  a       at
G  g      t  t
A  g      c  t
 Gt       a  t
 Cg       t  |
 Gt        gc
 Ta        at
            ttttgtagggagtacaaaaggcatgacattgacattgtcttttattgtatgatacatttttagggacataatgttacaaggttggtgtaactaATG


    ..................................................................................................................