                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=61 nt.     Delta G= -7.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGCCATTCGCAGATTATACAGGTGCTATCGAAGAAATTGATGTGGAGAAGAAGAAG
GTTAGCGTGCTTGTGGACATGTTTGGTCGCGAGACTCCAGTTGAACTTGACTTCCATC
AAATTGAAAAATTATAAaatgaaacttgaaatgaattgtaaaaagtgataatatcttttaagtcagtacgtcttcgttatcggagacg
ttttttgaaagattttatccttagagataaaatatgacgtgggagggcaaatcactgtccaattgaccacatcacggacttaaggaggtgtgtctcGTG

    BCE0095 Gene: rplK     GI: 42779178     BI number: BCE0097     GOG: COG0080     Description: ribosomal protein L1 aa a  g a  t a  g ta gt ta ta at |  a at gc t  | at at at gt ta ta cg at |  c |  a |  g |  t |  a       ta |  c      t  t |  g       gc |  t       cg |  c       tg at        ta at        cg gc        ta tg        gc at        cg at        at             tttttgaaagattttatccttagagataaaatatgacgtgggagggcaaatcactgtccaattgaccacatcacggacttaaggaggtgtgtctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0080 Ribosomal protein L11 ... can be seen here     ..................................................................................................................