                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:68 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:54 nt. Size=33 nt.     Delta G= -9.00 kcal/mol
Anti-antiterminator:    Distance from promoter:19 nt.    Size=49 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaaaa-tttaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaaaaaaaagtattagactcgatttaattgtcgataatggtatctaaagtagtaggtactatgggttaaaggctacctatttatgcaatatgaactaaa
aggttacctattgcataaataggtagccttttttatttaccattaaacagtcaaatgagggattcattGTG

    BCE0182 --- BCE0183 --- BCE0184 --- BCE0185 --- BCE0186 Gene: BCE0182     GI: 42779263     BI number: BCE0182     GOG: -------     Description: Tn7-like transposition protein A Gene: BCE0183     GI: 42779264     BI number: BCE0183     GOG: -------     Description: Tn7-like transposition protein B Gene: BCE0184     GI: 42779265     BI number: BCE0184     GOG: -------     Description: Tn7-like transposition protein C Gene: BCE0185     GI: 42779266     BI number: BCE0185     GOG: -------     Description: Tn7-like transposition protein D Gene: BCE0186     GI: 42779267     BI number: BCE0186     GOG: -------     Description: hypothetical protei ag a  g a  c t  t ta gc gc gt ta                   a at        aa       c  t |  t      a  a      g  a t  t       tg        ta c  a       cg        ta at        at        at tg        at        ta gc       |  a       cg |  a      g  c       cg g  a      t  c       at at        at        ta ta        ta        tg gt        at        gc |  g       at        gc a  a       cg        at ta        gc        at gc        ta        at at        at        at                         ttatttaccattaaacagtcaaatgagggattcattGTG     ..................................................................................................................