                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:168 nt.    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-18.00 kcal/mol
Antiterminator:    Distance from promoter:140 nt. Size=42 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:    Distance from promoter:138 nt.    Size=26 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tactat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaattctttttgtaagatttactattagtaccatattaaaaaaactacatacacatactcttatcaagagtggcggagggactggcccgatgatgc
ccggcaaccgagcttataacgtataagctaaggtgctaattcctgcaaaacgagttctcgttttggaagataagagaggaatctattttgtctattcggc
acctctcttatttttgagaggtgctttttattttggaacgtatatttaagggggaattatagATG

    BCE0197 --- BCE0196 --- BCE0195 Gene: BCE0197     GI: 42779278     BI number: BCE0197     GOG: COG1464     Description: ABC transporter, substrate-binding protein, putative Gene: BCE0196     GI: 42779277     BI number: BCE0196     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BCE0195     GI: 42779276     BI number: BCE0195     GOG: COG2011     Description: ABC transporter, permease protei             t           a  t           t  c            cg            tg            gc            ta           t  |           t  |           t  |           a  |           t  |           c  |       tt aa       t  |      a  t g  t      a  |      t  t gc       a  |      t  t at        gc        cg g  a       gc        ta at        at        cg gt        gc        ta at        at        cg at        gc        cg tg        at        at at        at        cg gc        ta        gc at        at        gt                         ttttattttggaacgtatatttaagggggaattatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987 This operon is putativelly rgulated by Methionine_S-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:141 nt.    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-12.70 kcal/mol Antiterminator:    Distance from promoter:138 nt. Size=26 nt.     Delta G= -5.20 kcal/mol Anti-antiterminator:    Distance from promoter:109 nt.    Size=44 nt.     Delta G=-10.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgaca-tactat. It has a score value of 74.97 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgacaattctttttgtaagatttactattagtaccatattaaaaaaactacatacacatactcttatcaagagtggcggagggactggcccgatgatgc ccggcaaccgagcttataacgtataagctaaggtgctaattcctgcaaaacgagttctcgttttggaagataagagaggaatctattttgtctattcggc acctctcttatttttgagaggtgctttttattttggaacgtatatttaagggggaattatagATG     BCE0197 --- BCE0196 --- BCE0195 Gene: BCE0197     GI: 42779278     BI number: BCE0197     GOG: COG1464     Description: ABC transporter, substrate-binding protein, putative Gene: BCE0196     GI: 42779277     BI number: BCE0196     GOG: -------     Description: ABC transporter, ATP-binding protein Gene: BCE0195     GI: 42779276     BI number: BCE0195     GOG: COG2011     Description: ABC transporter, permease protei tt g  c at                   t gc                 a  t cg                 t  c at                  cg at                  tg at                  gc at                  ta cg                 t  | |  g                t  | |  a                t  | |  a                a  | |  g                t  | |  a       aa       c  | |  t      g  t      t  | |  a       gc       a  | |  a       at       a  | |  g      g  a       gc |  a       at        gc g  g       gt        at ta        at        gc cg        at        at cg        tg        gc ta        at        at ta        gc        at at        at        ta                         tttttgagaggtgctttttattttggaacgtatatttaagggggaattatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1464 ABC-type metal ion transport system, periplasmic component/surface antigen ... can be seen here [P] COG2011 ABC-type metal ion transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................