Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.70 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACGGGGAAATTGCTAAAATACCACAAGGACTAAAAGAAGAATTAAGTATCTATTTTG
CAAAAATGCGGGAAAAGGGAAACATTATTGATACGAATATTGAAGCGCAAGTAATGAA
CTTTATCTGGATCAATTTTGGATATTTCTTATCTAAATTACGTTTTGCTGATCGCCTG
ACAGAAGTTGATGATGAGAAATTTATTGAAAATAATATTGTTTTATATGCTAGGGCAT
TAAGACCCTAGtatttatttaaaataaaatgcaagtatgtacttgcttgctaaaaggagagcgggaagATG

    BCE0213


Gene: BCE0213     GI: 42779294     BI number: BCE0213     GOG: -------     Description: conserved domain protei


           AA
          A  A
           GT
           TA
           TA
           AT
           TA
          T  T
          T  T
          A  G
          A  |
           AT
           GT
           AT
           GT
           TA
           AT
          G  A
          T  T
          A  |
          G  |
          T  |
           TG
           GC
 GA        AT
A  A      A  A
 CG       G  |       TA
 AT       A  |      T  A
 GT       C  |      A  G
 TG       A  |      C  A
C  A      G  |       GC
C  |       TG        GC
 GT        CG        GC
 CG        CG        AT
 TA        GC        TA
 AT       C  |       CG
G  G       TA        Gt
 TA        AT        Ta
 CG        GT        At
                        ttatttaaaataaaatgcaagtatgtacttgcttgctaaaaggagagcgggaagATG


    ..................................................................................................................