Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-15.70 kcal/mol
Antiterminator:    Distance from promoter:62 nt. Size=43 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:    Distance from promoter:31 nt.    Size=45 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-TAAGTT. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTATTAATAAACAAGAGCTTGTTAAGTTAAAGCAAGTTATTAGTCGAGTAGATGA
CGATGCTTTCGTCGTTATCCATGATGTACGTGATGTACTTGGCGGAGGCTTTAAAGCG
AGCTAAaaggtgaacgagtaaattcgttcacctttttttaattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattgtatttct
tctttttaaaatggatgtatatatatcctgcagaggaggaatgtttattATG

    BCE0235


Gene: BCE0235     GI: 42779316     BI number: BCE0235     GOG: -------     Description: conserved hypothetical protei


  G
T  T
A  A       GA
 GC       C  G
 TG        GC
 AT        AT
C  |      A  A
 CG       A  A
 TA        Ta
 AT        Ta
 TG        Tg
|  T       Cg        aa
|  A       Gt       t  a
|  C      G  g       gt
T  T      A  a       at
 GT       G  a       gc
 CG       G  |       cg
 TG       C  |       at
 GC       G  |       at
 CG        Gc        gc
 TG        Tg        ta
 TA        Ta        gc
 TG        Cg        gc
 CG        At        at
 GC        Ta        at
                        tttttaattcttacaaaaatgtaagtgtaatgtaatgagattcaatagtagattgtatttcttctttttaaaatggatgtatatatatcctgcagaggaggaatgtttattATG


    ..................................................................................................................