                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:56 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGTCTGTTGATAAGGTTATGAAAACGATATATGAAAATACGATTCAATTTTACCCCA
CATTAACGGGCAATAAGACTCCCACCTCAAAATTCGACTAAtgcggaggagttaggtgggagatcaactg
cccgtaaaagcctgattggttcaactaataaccagtgggggatggacattaaagtttcactttatttgaaaggataggagcgttactcttatccctttta
ttatggatattttttctaatattttctataatttatgatgtgtttaatttgatgaaggaagtagggaagaaaATG

    BCE0238 Gene: BCE0238     GI: 42779319     BI number: BCE0238     GOG: -------     Description: lipoprotein, putativ aa g  a tg tg ta         t at       g  t ta       c  a t  |       gc t  |       at c  |       gc a  |       gt cg        at tg        ta ta        at tg        gc gc        gc             cttttattatggatattttttctaatattttctataatttatgatgtgtttaatttgatgaaggaagtagggaagaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:71 nt.     Distance to run of Ts=1 nt.   Size=23 nt.     Delta G=-10.80 kcal/mol Antiterminator: Size=28 nt.     Delta G= -3.20 kcal/mol Anti-antiterminator:   Size=50 nt.     Delta G=-14.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATGTCTGTTGATAAGGTTATGAAAACGATATATGAAAATACGATTCAATTTTACCCCA CATTAACGGGCAATAAGACTCCCACCTCAAAATTCGACTAAtgcggaggagttaggtgggagatcaactg cccgtaaaagcctgattggttcaactaataaccagtgggggatggacattaaagtttcactttatttgaaaggataggagcgttactcttatccctttta ttatggatattttttctaatattttctataatttatgatgtgtttaatttgatgaaggaagtagggaagaaaATG     BCE0238 Gene: BCE0238     GI: 42779319     BI number: BCE0238     GOG: -------     Description: lipoprotein, putativ ct a  a a  a c  t ta ta gc gc ta tg at g  g       ta tg       t  a cg        aa cg        cg g  g       at         t a  |       gt       g  t a  |       gt       c  a a  |      t  |       gc a  |      a  |       at ta       g  |       gc gt       g  |       gt cg        gc        at cg        ga        ta c  a       gc        at gc        tt        gc ta        gt        gc                         cttttattatggatattttttctaatattttctataatttatgatgtgtttaatttgatgaaggaagtagggaagaaaATG     ..................................................................................................................