                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Guanine_G-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:148 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:95 nt. Size=63 nt.     Delta G=-23.40 kcal/mol
Anti-antiterminator:    Distance from promoter:68 nt.    Size=59 nt.     Delta G=-13.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-taatat. It has a score value of 74.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacaaaactacttcgtcgagttaatatgagtatgtaattcaaacgaaaagtgaatattatgccgtcgtataatatcggggatatggcccgaaagtttc
tacCTAGCTACCGTAAATGGCTTGACTACGAGGCGTTTTTATAAAGGTGAGGGGAATCT
TATCTTTATTCATAGAACGCTTCCATGTATATGCAATGGAAGCCTTTTTTATTTTTAA
TAGATAAAAGAGGGCTAGGGGATTACGGCGAGTAATCATataacgggggaaacgtaagATG

    BCE0293 Gene: BCE0293     GI: 42779374     BI number: BCE0293     GOG: COG2252     Description: xanthine/uracil permease family protei            GA           G  A CT        GT A  A       GC GC        AT TG        GT TA        TA CG        GT G  G       GC GC        AT TG        AT AT        AT AT        TA AT        AT |  T      |  T |  T      |  C T  A      |  A G  T      T  T C  A       TA C  A       TG A  A       TA        TA TG        TA       A  T CG        GC        TG GT        CG        GC A  G       GC       |  A TA        GT        TA CG        AT        AT cG        GC        CG a  |      C  C       CG tG       A  A       TA cG       T  T       TA tA        CG        CG tA        AT        GC                         CTTTTTTATTTTTAATAGATAAAAGAGGGCTAGGGGATTACGGCGAGTAATCATataacgggggaaacgtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Guanine_G-box sequence ... can be seen here     ..................................................................................................................