                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:160 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-16.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G=-10.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGGAGTATTCGAGCTGAATATGAGGATGGTGTTATTCAGTTTGTCGTCTCGTTGCCA
ATTATAGAAAGATAAtaaacgaatagaatggtatatgataaaaaggcttattTTAAAAGAAATAAGCCTTTTT
ATATTTTTTTAGAAAAATATATTGACGATTAGAGATTAGAGGTGTAATATTATACGAG
TCGCCGATGACAACAACGTCGAAAGCGACAAACGAAATGAAAAACTTAGTTGACATta
actaacgaagatgttaacataaggaagtcgcaaatgagcgaccaagtagttctTTG

    BCE0297 Gene: BCE0297     GI: 42779378     BI number: BCE0297     GOG: -------     Description: hypothetical protei            AA           G  A           A  G            TA            AT            TA            TA            At           |  a           |  a           |  a           |  c           |  g           |  a           |  a           |  t           |  a           |  g           |  a           |  a            At            Cg            Cg            Gt            Ta        AA AT       T  t      A  A G  G      G  |       TG G  G      C  |       TA A  T      T  |       tA G  G      C  |       tA T  T       Ta        aT AT        Gt        tA TA        Cg        tA AT        Ta        cG AT        Gt        gC GC        Ta        gC TA        Ta        aT CG        Ta        aT GT       G  a       aT AT       A  a       aT GT        Cg        aT CG        Tg        tA                         TATTTTTTTAGAAAAATATATTGACGATTAGAGATTAGAGGTGTAATATTATACGAGTCGCCGATGACAACAACGTCGAAAGCGACAAACGAAATGAAAAACTTAGTTGACATtaactaacgaagatgttaacataaggaagtcgcaaatgagcgaccaagtagttctTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:169 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-11.70 kcal/mol Antiterminator: Size=68 nt.     Delta G= -7.30 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G= -5.70 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGGGAGTATTCGAGCTGAATATGAGGATGGTGTTATTCAGTTTGTCGTCTCGTTGCCA ATTATAGAAAGATAAtaaacgaatagaatggtatatgataaaaaggcttattTTAAAAGAAATAAGCCTTTTT ATATTTTTTTAGAAAAATATATTGACGATTAGAGATTAGAGGTGTAATATTATACGAG TCGCCGATGACAACAACGTCGAAAGCGACAAACGAAATGAAAAACTTAGTTGACATta actaacgaagatgttaacataaggaagtcgcaaatgagcgaccaagtagttctTTG     BCE0297 Gene: BCE0297     GI: 42779378     BI number: BCE0297     GOG: -------     Description: hypothetical protei            at           g  a           t  a            aa            ta            aa            tg            gg           |  c           |  t           |  t           |  a           |  t           |  t           |  T           |  T           |  A           |  A           |  A           |  A            g            t   A        a A  T       a C  T       g C  A      a GT       t  | TA       a  | TG       a  | G  A      g  |       AA C  A       c       A  A TA        a        TG CG        a        TA TA        a        tA G  T       t        tA C  A       A        aT TA        A        tA Gt        T        tA Ta       A         cG Ta       G         gC Ta        A        gC Gc        A        aT                         TTTTATATTTTTTTAGAAAAATATATTGACGATTAGAGATTAGAGGTGTAATATTATACGAGTCGCCGATGACAACAACGTCGAAAGCGACAAACGAAATGAAAAACTTAGTTGACATtaactaacgaagatgttaacataaggaagtcgcaaatgagcgaccaagtagttctTTG     ..................................................................................................................