Gene putatively regulated by attenuation in B_cereus_ATCC_10987
Characteristics of the secondary structures
Terminator: Distance from promoter:88 nt. Distance to gene:127 nt. Distance to run of Ts=0 nt. Size=30 nt. Delta G= -8.30 kcal/mol
Antiterminator: Distance from promoter:59 nt. Size=45 nt. Delta G= -3.80 kcal/mol
Anti-antiterminator: Distance from promoter:36 nt. Size=37 nt. Delta G= -3.90 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGACG-TTCAGT. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGACGTTTCACGTTGTTTGTTTCGTTCAGTTTTCAAagaactacttagtcgctcatttgcgacttccttatg
ttaacattttcatctttcaatgtcaactaagtttttcatttcgtttgtcgctttcaacgttgttgtcatcggcgacttgttttatattacacccctattc
agtaatagtcaacattaatctttcgcttttttagaaaagatgaaacagctactcatattcctctttattttccatacatataattaaaatatccgaaagg
ggtgtaggggTTG
BCE0315
Gene: BCE0315 GI: 42779396 BI number: BCE0315 GOG: ------- Description: hypothetical protei
c
t g
t t
t t
at
cg
tc t t
a t t c
c t t | t
t t t | g t
t c tg cg
ta gc at
ta at at
at at cg
cg t t | t
at c c | c
a c a a | a
ta a | t t
ta c | t c
gc ta tg
t | gc cg
at tg gc
ta at cg
ta at ta
cg cg gc
ttgttttatattacacccctattcagtaatagtcaacattaatctttcgcttttttagaaaagatgaaacagctactcatattcctctttattttccatacatataattaaaatatccgaaaggggtgtaggggTTG
..................................................................................................................