                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-18.00 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G= -6.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GACAAACCACAGTCAAATGGAAGTTATGACGCTTCTGACAAAGAGATTGAGTCAGCGA
TTGAAGATATAATCCTGGCAAAACCGCTTTGAatcatttgtcacgatgcaagatgctctcaaagggacttagctgc
tgcagtgggcggttaagtcttctttattttatcacaaaaatagaacatatattctcatttcagacattaaaatatacataatcaataaaattcagaaaat
taggtgtaaacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG

    BCE0330 --- BCE0329 Gene: BCE0330     GI: 42779411     BI number: BCE0330     GOG: -------     Description: SPFH domain/band 7 family protein Gene: BCE0329     GI: 42779410     BI number: BCE0329     GOG: COG4877     Description: conserved domain protei TT T  G C  A G  a C  t C  c A  a At At At Cg         a Gt       a  a Gc       c  g Ta        tg        ag C  c       cg       c  t Cg        ta       g  g Ta       |  c       tg At       |  t       cg |  g      |  t       gc |  c      |  a       tg |  a       cg        cg |  a       gc        gt A  g      t  t       at Ta       a  g       ta At       g  c       ta Tg       a  |       cg |  c       at        at At        cg        gc Gc        gc        gt At        ta        gt                         ctttattttatcacaaaaatagaacatatattctcatttcagacattaaaatatacataatcaataaaattcagaaaattaggtgtaaacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4877 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:143 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-15.90 kcal/mol Antiterminator: Size=34 nt.     Delta G= -4.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GACAAACCACAGTCAAATGGAAGTTATGACGCTTCTGACAAAGAGATTGAGTCAGCGA TTGAAGATATAATCCTGGCAAAACCGCTTTGAatcatttgtcacgatgcaagatgctctcaaagggacttagctgc tgcagtgggcggttaagtcttctttattttatcacaaaaatagaacatatattctcatttcagacattaaaatatacataatcaataaaattcagaaaat taggtgtaaacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG     BCE0330 --- BCE0329 Gene: BCE0330     GI: 42779411     BI number: BCE0330     GOG: -------     Description: SPFH domain/band 7 family protein Gene: BCE0329     GI: 42779410     BI number: BCE0329     GOG: COG4877     Description: conserved domain protei   t a  g g  c ca aa cg        ag |  a      c  t |  t      g  g |  g       tg |  c       cg tt        gc gc        tg t  t       cg t  c       gt t  a       at a  |       ta ca        ta ta        cg ag        at Ag        gc             ttctttattttatcacaaaaatagaacatatattctcatttcagacattaaaatatacataatcaataaaattcagaaaattaggtgtaaacctcttgcttaaaatgatataaaagtgatatcatttttatatcaggaggcgatcatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4877 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................