                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:45 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-14.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGAGAAATAAAGCTCGATATTCCTGTCCAGTTTAATGGGAAAGCAGAAATAATTGGC
TTTACACAATATGTAGCCGGGCTTGTTATGGAATACTTCCCGAATTATATGAAAGTAC
AAGTAACGATTAAATCTGTAGAGCGTCCAGAAGCGATTATTATACGTGAAGCGAAGCA
AGATGAACCGTATGTGAAAATTTTAGATTAAatacaagggctgttcctttatggaacggctttttttcttgggtaat
tttgttataatttaaaatgttgtaaataatggggtaaggggtaaagcgcATG

    BCE0337 Gene: BCE0337     GI: 42779418     BI number: BCE0337     GOG: -------     Description: membrane protein, putativ GA A  T T  T TA TA Ta At A  a A  | A  |        t Gc       t  a Ta       t  t G  a       cg T  g       cg A  g       ta Tg        ta Gc        gc C  t       tg Cg        cg At        gc At        gt Gc        gt             tttttcttgggtaattttgttataatttaaaatgttgtaaataatggggtaaggggtaaagcgcATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:58 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.70 kcal/mol Antiterminator: Size=42 nt.     Delta G= -3.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AAGAGAAATAAAGCTCGATATTCCTGTCCAGTTTAATGGGAAAGCAGAAATAATTGGC TTTACACAATATGTAGCCGGGCTTGTTATGGAATACTTCCCGAATTATATGAAAGTAC AAGTAACGATTAAATCTGTAGAGCGTCCAGAAGCGATTATTATACGTGAAGCGAAGCA AGATGAACCGTATGTGAAAATTTTAGATTAAatacaagggctgttcctttatggaacggctttttttcttgggtaat tttgttataatttaaaatgttgtaaataatggggtaaggggtaaagcgcATG     BCE0337 Gene: BCE0337     GI: 42779418     BI number: BCE0337     GOG: -------     Description: membrane protein, putativ TT T  A T  G AA AT AT AA G  A        t T  |      t  a G  |      t  t Ta        cg At        cg T  a       ta G  c       ta C  a       gc Ca        tg Ag        cg A  g       gc Gg        gt Tc        gt At        at Gg        at             tttcttgggtaattttgttataatttaaaatgttgtaaataatggggtaaggggtaaagcgcATG     ..................................................................................................................