                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:102 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -8.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGATTCATTTAAGTATTGCTTATGCAATTTGGTCTGGTGTTGGGACGTTACTTATTA
CGATTATTAGTGTGTACTTTTTTAAAGAGCACATTAGCCTATTCCAAGCATTTTGTAT
TCTTTTCATCGTGTTAGGAGTAATTGGGCTTAAGGTTTCATCGGCATCATGAaagctatct
tttgtagaagatagcttttttctatttgtgcagttagcaattaatacgacaaaatatgacaagaaagagtaaagcgttttgttatgatatatatggaatt
ttgtcttatgtggaggaaagagtATG

    BCE0358 Gene: BCE0358     GI: 42779439     BI number: BCE0358     GOG: -------     Description: lipoprotein, putativ   C T  G AT CG T  T T  T TA TG CG TA TG AT TA G  A T  T        C        gt T  T      G  A      t  a T  G      G  T       tg T  G      C  C       ta A  |       TA        ta CG        AT        cg GC        CG        ta AT        TA        at AT        Ta        ta |  A       Ta        cg |  A      G  g       gc CG        Gc        at CG        At        at                         ttttctatttgtgcagttagcaattaatacgacaaaatatgacaagaaagagtaaagcgttttgttatgatatatatggaattttgtcttatgtggaggaaagagtATG     ..................................................................................................................