                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.70 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=57 nt.     Delta G= -6.29 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTTATA-GAATAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTATATAATAGACCATAAAGCGGAATATGCTCATTTCATACTGACGGGAGAAGTGGA
TGAAAATAAGTAAataaaattaaactaggataagaagaagggcttcatctataggattgaggctcttttcttttgtcctttttcataaagg
ggcggtgtttATG

    BCE0397 Gene: BCE0397     GI: 42779478     BI number: BCE0397     GOG: COG4626     Description: phage terminase, large subunit, putativ            ta           c  g           a  g           a  a            at            ta            ta           a  g   A       a  a G  G      a  a G  A      a  g G  A      t  a CG       a  a AT       A  g G  |      A  g TG        Tg CG        Gc         t A  |       At       a  a TA       A  |      t  g AT       T  |       cg CG       A  |       ta TA       A  |      |  t TA       A  |       at TA        At        cg |  A       Gc        ta A  T       Ta        tg C  A       At        cg TA        Gc        gc CG        Gt        gt GT        Ta        gc TA        Gt        at                         tttcttttgtcctttttcataaaggggcggtgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4626 Phage terminase-like protein, large subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:64 nt.    Distance to gene:26 nt.     Distance to run of Ts=1 nt.   Size=34 nt.     Delta G=-14.50 kcal/mol Antiterminator:    Distance from promoter:32 nt. Size=57 nt.     Delta G= -6.29 kcal/mol Anti-antiterminator:   Size=42 nt.     Delta G= -5.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTATA-GAATAT. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTATATAATAGACCATAAAGCGGAATATGCTCATTTCATACTGACGGGAGAAGTGGA TGAAAATAAGTAAataaaattaaactaggataagaagaagggcttcatctataggattgaggctcttttcttttgtcctttttcataaagg ggcggtgtttATG     BCE0397 Gene: BCE0397     GI: 42779478     BI number: BCE0397     GOG: COG4626     Description: phage terminase, large subunit, putativ            ga           a  a           a  g           t  a            aa            gg            gg           a  g   A       t  c G  G      c  t G  A      a  t G  A      a  c CG       a  a AT       t  t        t G  |      t  c      a  a TG        at       t  g CG        aa        cg A  |       at        ta TA       a  |      |  t AT       t  |       at CG       a  |       cg TA       A  |       ta TA       A  |       tg TA        Ta        cg |  A       G        gc A  T       A        gt C  A       A        gc TA        T        at CG        A        at GT        A        gt TA        A        at                         cttttgtcctttttcataaaggggcggtgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4626 Phage terminase-like protein, large subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:70 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -6.50 kcal/mol Antiterminator:    Distance from promoter:32 nt. Size=57 nt.     Delta G= -6.29 kcal/mol Anti-antiterminator:    Distance from promoter:3 nt.    Size=42 nt.     Delta G= -5.20 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTTATA-GAATAT. It has a score value of 60.24 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTATATAATAGACCATAAAGCGGAATATGCTCATTTCATACTGACGGGAGAAGTGGA TGAAAATAAGTAAataaaattaaactaggataagaagaagggcttcatctataggattgaggctcttttcttttgtcctttttcataaagg ggcggtgtttATG     BCE0397 Gene: BCE0397     GI: 42779478     BI number: BCE0397     GOG: COG4626     Description: phage terminase, large subunit, putativ            ga           a  a           a  g           t  a            aa            gg            gg           a  g   G       t  c A  T      c  t A  G      a  t G  G      a  c AA       a  a GT       t  t G  |      t  c GG        at CA        aa A  |       at GA       a  | TA       t  |        t CA       a  |      a  a AT       A  |      t  g TA       A  |       cg AA        Ta        ta |  G       G       |  t C  T       A        at T  A       A        cg TA        T        ta Ta        A        tg At        A        cg Ca        A        gc                         tcttttcttttgtcctttttcataaaggggcggtgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4626 Phage terminase-like protein, large subunit ... can be seen here     ..................................................................................................................