Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:12 nt.    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-22.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaga-taaact. It has a score value of 60.91 and is shown in blue

tcgagattcctaaataaaatattaaactattaatttatctagcctgcgggggttcttcccttgcaggctctttttttatgccttgatttaattaaattct
acaaatcctcaacttcgacctgttcccacggctattaggtaggaggtgattcctaGTG

    BCE0416


Gene: BCE0416     GI: 42779497     BI number: BCE0416     GOG: -------     Description: hypothetical protei


           c
         t  t
         t  t
          gc
          gc
          gc
          gt
          gt
          cg
          gc
          ta
          cg
          cg
          gc
          at
            ctttttttatgccttgatttaattaaattctacaaatcctcaacttcgacctgttcccacggctattaggtaggaggtgattcctaGTG


    ..................................................................................................................