                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:133 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -6.30 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=40 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:38 nt.    Size=76 nt.     Delta G= -5.13 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgata-tagaat. It has a score value of 73.63 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgataaataaaataaaatgaactagaatctttttgaacaatttttgtcctctcaaatatataattaggaagcatattgcaatgatatagaaacattgac
tcaagaggttaacaagatataataaaacctagatatacctttcaaaaagaagaagatataatataggatgaaaaaatttcaccctattattttttatagc
ttttagaaaacgcttacaattagtgtggaggggaaaccATG

    BCE0441 --- BCE0442 --- BCE0443 Gene: BCE0441     GI: 42779522     BI number: BCE0441     GOG: -------     Description: 5-methylthioribose kinase, putative Gene: BCE0442     GI: 42779523     BI number: BCE0442     GOG: -------     Description: 5-methylthioribose kinase, putative Gene: BCE0443     GI: 42779524     BI number: BCE0443     GOG: -------     Description: translation initiation factor, putative, aIF-2BI famil   a a  g c  a tg cg at gt ta ta a  c c  a a  a a  g a  a g  | at ta at ta |  a        a |  t      a  a |  a      a  a a  a       cg g  a       ta t  a       ta a  c       tg a  c      c  a c  t      c  a g  a      a  g        a tg        ta       a  a ta        at        at at        ta        at ta        at        at at       |  a       gc |  a      |  a       ta c  c      |  t      a  c gc       g  a       gc at        at        gc at        ta        at gt        cg        ta gc        cg        at                         tattttttatagcttttagaaaacgcttacaattagtgtggaggggaaaccATG     ..................................................................................................................