                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Methionine_S-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:169 nt.    Distance to gene:33 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.80 kcal/mol
Antiterminator:    Distance from promoter:136 nt. Size=49 nt.     Delta G= -5.23 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=57 nt.     Delta G=-11.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcac-tacaat. It has a score value of 69.61 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcacagaaaaaggaaatgaattacaattttaatatcacgaaaattcagaactttaaattgaatatacctttatcaagagaggcagagggaccggccct
ttgaagcccagcaacctcagtttatacaaactgaataggtgctaattcctgcaaaatgcattgcattttgaaagataaaacgtaactattgtgtgcaaaa
ctcatctttcttgattatgaaaggtgagttttttatatttcaaaatatatacttggaggtatttaaaGTG

    BCE0461 Gene: BCE0461     GI: 42779541     BI number: BCE0461     GOG: COG1878     Description: conserved hypothetical protei   t a  t cg gc ta at        tt at       a  g at       t  t at        cg cg        at g  a      |  g t  a      a  c c  a      t  a cg       g  a ta       c  a       at |  t      a  a      g  t |  a      a  c      t  a t  a      a  t      t  t a  a      a  c       cg a  a       ta        ta t  c       at        ta cg        gc        ta gt        at        cg ta        at        tg g  a       at        at gc        gc        cg at       t  t       ta ta       t  t       cg at        tg        at at        ta        at                         ttttatatttcaaaatatatacttggaggtatttaaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1878 Predicted metal-dependent hydrolase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Methionine_S-box sequence ... can be seen here     ..................................................................................................................