                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -4.40 kcal/mol
Anti-antiterminator:   Size=72 nt.     Delta G= -5.81 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AATATAAAGCAAAAATGAATGAGGCGATGTCTTTTTTAGCGAAAGCGAAATCAGTTCG
TGATAAATTAGAACGAATTTATATTGCTGCTATGGATTTTTCAAAAGTAGATGCATAC
AAAGAGGAGATTCAAAAAGAGTTTGAACGAATTGCGGTTAGTGTAACTGAAAAGAACA
AGTAAaaaataacgaattttgacaggctgtcggaaattttctgacagctattttagtatgtagtaaacttagtaatatatttgtcgaatttccaagg
aaataatcaaaaaatggagagggtatgaaATG

    BCE0463 Gene: BCE0463     GI: 42779543     BI number: BCE0463     GOG: COG3541     Description: conserved hypothetical protei   T G  G AT TA TA GC GT CG |  A |  A G  A T  A T  G A  A A  A G  C C  A A  A A  G GT TA TA Ta G  a A  a G  a A  t                  t A  a                a  t A  a        g        at A  c      g  c       at A  |      a  t       gc Cg        cg        gt Ta        at        cg Ta        gc        ta At        tg        gc Gt        tg        ta At        ta        cg Gt        ta        gc                         tattttagtatgtagtaaacttagtaatatatttgtcgaatttccaaggaaataatcaaaaaatggagagggtatgaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG3541 Predicted nucleotidyltransferase ... can be seen here     ..................................................................................................................