                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=1 nt.   Size=38 nt.     Delta G=-13.40 kcal/mol
Antiterminator: Size=70 nt.     Delta G= -6.37 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtttgcctttctcgctgaacgagttgaacgatatgggagttctatgagaattacattgttctctatcaaagattacaacataaaaattaaaatgtctacc
tatttagagatgcaaatgcaaagttttaatgtattattttttcgaaataatttaacaaagtacgtgaatgttacatttcttgtgttatataataaaaaat
gtatataacacaaggattgttttgagtatttattttaattttcatttaaattaaattattcgaatatatcttaactaatgaatttcggaggtagtttatc
ATG

    BCE0488 Gene: BCE0488     GI: 42779568     BI number: BCE0488     GOG: COG2704     Description: anaerobic C4-dicarboxylate membrane transporte            ta           t  a           t  c           a  a           a  a           t  a           a  g           a  t           a  a aa        gc a  t       cg cg       t  t gc       t  | ta       t  | |  a       tg |  a       ta a  g       ta gt        at at        tg gt       t  t       aa at        at       a  a ta        ta       a  a ta        gc       t  t t  t       ta       a  g a  |       at        at t  |       at        ta c  |      t  t       at cg       t  |       ta at       t  |       at ta       t  |       ta c  t       gc        ta t  |       at        gc gt       a  |       ta ta        at        gc at        cg        ta at        gt        ta at        tg        cg at        at        tg                         attgttttgagtatttattttaattttcatttaaattaaattattcgaatatatcttaactaatgaatttcggaggtagtttatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2704 Anaerobic C4-dicarboxylate transporter ... can be seen here     ..................................................................................................................