                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:180 nt.    Distance to gene:46 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-14.00 kcal/mol
Antiterminator:    Distance from promoter:148 nt. Size=48 nt.     Delta G= -7.70 kcal/mol
Anti-antiterminator:    Distance from promoter:114 nt.    Size=43 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-tgtaat. It has a score value of 68.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaatctttgatagagaacaatgtaattctcatagaactcccatatcgttcaactcgttcagcgagaaaggcaaactggtggaaacattaggacgcaa
aactacaggagctaaggccgaaaggctacgctagccagttaccggacggatagggttggtcttgaccaatgctttttcattggtcttttttttatttgcg
aacaaatgagaaaccttatcagctgttgataaggtttctattttaatagttttcctttatattaatttaattaagaaaggtgatgttgATG

    BCE0489 Gene: BCE0489     GI: 42779569     BI number: BCE0489     GOG: -------     Description: methyl-accepting chemotaxis protei            ga tt       c  a c  g       gc ta        ta gc        ta gc        ta ta        at ta        tg gt        ta g  g       tg gc        ta         t at        ta       c  g |  t       ta        gt |  t      |  c       at |  t      t  c       cg |  t      t  t       ta |  c      c  t       at ta        ta        ta at        gt        ta gt        gc        cg g  g       ta        cg cg        tg        at at       |  c       at gc        at        at gt        cg        gc                         tattttaatagttttcctttatattaatttaattaagaaaggtgatgttgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:134 nt.    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G= -9.20 kcal/mol Antiterminator:    Distance from promoter:122 nt. Size=22 nt.     Delta G= -8.10 kcal/mol Anti-antiterminator:    Distance from promoter:100 nt.    Size=31 nt.     Delta G= -9.40 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtaa-tgtaat. It has a score value of 68.27 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtaatctttgatagagaacaatgtaattctcatagaactcccatatcgttcaactcgttcagcgagaaaggcaaactggtggaaacattaggacgcaa aactacaggagctaaggccgaaaggctacgctagccagttaccggacggatagggttggtcttgaccaatgctttttcattggtcttttttttatttgcg aacaaatgagaaaccttatcagctgttgataaggtttctattttaatagttttcctttatattaatttaattaagaaaggtgatgttgATG     BCE0489 Gene: BCE0489     GI: 42779569     BI number: BCE0489     GOG: -------     Description: methyl-accepting chemotaxis protei ga g  c cg cg a  a t  t       tt        tt t  a      c  g      t  t g  g       ta       c  t a  |       gc        gc cg        gc        ta cg        ta        at gt        ta        at at        gt        cg tg       g  g       cg cg        gc        at gt        at        gc                         ttttttttatttgcgaacaaatgagaaaccttatcagctgttgataaggtttctattttaatagttttcctttatattaatttaattaagaaaggtgatgttgATG     ..................................................................................................................