                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:29 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G=-18.70 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=72 nt.     Delta G=-22.40 kcal/mol
Anti-antiterminator:    Distance from promoter:65 nt.    Size=59 nt.     Delta G=-13.12 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tataca-taaaat. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatacatgcttttgtttgttcaataaaataaatcatgctacaatgaaaacgaattaaggaccggggagccaattggctgagaggatgtgagtaaacatcg
accctcaacctgatctggataatgccagcgtagggagttacttaaagtgatgtagcatatgttattctataataacttgcatacaaggctttcctacgca
gtaggaaagccttttcttgttttaaaatttaatttcataagggggattttactATG

    BCE0490 --- BCE0491 --- BCE0492 --- BCE0493 Gene: BCE0490     GI: 42779570     BI number: BCE0490     GOG: COG0011     Description: conserved hypothetical protein Gene: BCE0491     GI: 42779571     BI number: BCE0491     GOG: COG0600     Description: ABC transporter, permease protein, putative Gene: BCE0492     GI: 42779572     BI number: BCE0492     GOG: -------     Description: ABC transporter, substrate-binding protein, putative Gene: BCE0493     GI: 42779573     BI number: BCE0493     GOG: -------     Description: ABC transporter, ATP-binding protei            ta           c  t            ta            ta            at            ta            ta            gc aa       t  t t  t      a  | a  g      t  | gc        at gc        cg ta        gc cg       |  a t  c       at a  g       ta gt        gc ta        ta cg       a  a cg       g  g a  |       tg a  |       gc cg        at ta       a  | cg       a  | |  t      t  | |  t      t  |        c |  a      c  |      g  a |  c      a  |       cg |  t      t  |       at |  t      t  |       ta |  a      g  |       cg c  a       at        cg c  a       gt        ta a  g       gc        ta gt        gc        ta cg        at        cg ta        ta        gc at        gc        gc cg        cg        at at        gc        at                         ttcttgttttaaaatttaatttcataagggggattttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG0011 Uncharacterized conserved protein ... can be seen here [P] COG0600 ABC-type nitrate/sulfonate/bicarbonate transport system, permease component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................