Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:16 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=58 nt.     Delta G= -3.99 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAACTCTTGGCACCAAGAGAAGCAAACAATCGTTATGGTTACACACGACTTAGATG
AGGCAATCTTGCTTTCGGATCGCGTATTTATTTTATCTCAAAGACCAGCATCAATAGT
TGGTGAGGTACAAGTGAAATTACCTAGGCCGAGAACGATGGATATGTTAACATCACTT
GAGTTAAAGAAGGATAAGGAAGAAATTTTGAGAGTATTAGCACCTTATATGAAAAAAT
AGaaaaagtcttttaacagtttttagtataattactgttaagaggcttttttatatagggggagaaagGTG

    BCE0494


Gene: BCE0494     GI: 42779574     BI number: BCE0494     GOG: -------     Description: hypothetical protei


           AA
          A  A
          G  A
           TA
           AT
           TA
          A  G
          T  a
          T  a
          C  a
          C  a
 AA       A  a
G  A       Cg
 AT        Gt
 AT       A  |
 GT       T  |
 GT       T  |
A  G      A  |
A  A      T  |
T  G       Gc
A  A       At
G  G       Gt         t
G  T       At       g  a
A  A       Gt        at
A  T       Ta        ta
G  T       Ta        ta
A  A      T  c      t  t
A  G      T  a      t  t
A  C      A  g       ta
T  A      A  |       gc
T  C       At        at
 GC        Gt        cg
 AT        At        at
 GT        At        at
 TA        Gt        ta
T  T      G  a       ta
C  A      A  g       tg
 AT        At        ta
 CG        Ta        cg
 TA        At        tg
                        cttttttatatagggggagaaagGTG


    ..................................................................................................................