Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:78 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-20.20 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -6.23 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agaatataaaagagtagtttatactcttaatataacgaatgttaaaggagtgaaaggataaaatgactttatcaactgttcttcaaatggttttagcttg
ataagggagaagtctgcccatttttatcggttaagctaaattgaagacagcaggtaaagaaccttaatccttttttacgataatatgtaatgggtaaggt
gtattcaccttacccattttttatatgcacaattaaaaaaggctttatactgttgctctctctatttagcttatggactataagtagaggagagaaaaaa
ATG

    BCE0495


Gene: BCE0495     GI: 42779575     BI number: BCE0495     GOG: -------     Description: ABC transporter, ATP-binding protei


  a
a  g
a  a
 ta
 gc
 gc
 at
c  t
g  a
a  a
c  t
a  c
 gc
 at        aa
 at       t  t
 gt       a  a
t  t       gt
t  t       cg
a  t       at
a  a       ta
a  |       ta        at
t  |      t  t      t  t
c  |      t  |       gc
g  |      t  |       ta
a  |      t  |       gc
a  |       cg        gc
t  |       cg        at
t  |       tg        at
g  |      a  |       ta
 gc        at        gc
 cg        ta        gc
 ta        ta        gc
 at        cg        ta
 ta        cg        at
 ta        at        at
                        ttttatatgcacaattaaaaaaggctttatactgttgctctctctatttagcttatggactataagtagaggagagaaaaaaATG


    ..................................................................................................................