                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:93 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=30 nt.     Delta G= -6.60 kcal/mol
Anti-antiterminator:   Size=26 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAATCTTACAAAACAAAATAACATTCATAACTCATCTAACAACTCATCACCATTATT
TTTCTTTGCGGGATCTGATAATGATAGCTCGCATGGAGGTTCACATGATTGTGGAGGA
TCTTTCGGTGGAGATAGCGGAGGCAGCTGCGATGGTGGCGGAGGTGGCGGTGATTGAT
GAGAATACGCCCTATAAGGGGCGTATTTCTTTTTAAacaaacgtttgattagttggtttacatatgcataaaa
acagttaaacaaacgtttgattaaatatttttaatatactaaggggaatggaaATG

    BCE0502 Gene: BCE0502     GI: 42779582     BI number: BCE0502     GOG: -------     Description: hypothetical protei            TG           A  A           G  G GC        TA        TA G  G       TA       A  A T  G       AT        TG G  A      |  A       CG G  G       GC        CG TG        TG        CG AT        GC        GC G  G       GC        CG CG       C  |       AT GC        GC        TA TG        GT        AT CG        TA        AT GT        GT        GT                         CTTTTTAAacaaacgtttgattagttggtttacatatgcataaaaacagttaaacaaacgtttgattaaatatttttaatatactaaggggaatggaaATG     ..................................................................................................................