                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:149 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -9.90 kcal/mol
Antiterminator:    Distance from promoter:99 nt. Size=56 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGA-TACAGT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGAAACTAATTGAAGCAGGCATACAGTCTGGAGAGTTTCGTGAAGATAATACGCG
CGATCTTATGTATATTGTGAATGGATTATTATCAGGGCTTGGAGTACTTTACTACGAG
TTAGATTATAAAGAGTTGAAACGTATTTATAAAAAGGCAATAGATGTATTGTTAAAAG
GAATGGCAGCTGAATAAtaagtcagttgcttttctataaaataaattagaccgaacggtcggtttatgaaaggggaatgaaaATG

    BCE0504 Gene: BCE0504     GI: 42779584     BI number: BCE0504     GOG: -------     Description: major facilitator family transporte AT G  G AT TA AT AT CG GT GT A  A A  A A  A A  A A  G T  | A  | TG TA TA AT        At TG       A  a G  G      T  a C  |      A  g A  |       At A  |       Gc A  |       Ta GC        Cg TA        Gt TG        At GC        Cg AT        Gc             ttttctataaaataaattagaccgaacggtcggtttatgaaaggggaatgaaaATG     ..................................................................................................................