Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-12.80 kcal/mol
Antiterminator: Size=33 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCAACTTGTACCAGAAAATATGATTGGAAGAGTAAATGGAACAATTTTACCACTGTTT
ATGGGGGCAATGTTAATCGGAACTTCAATAGCTGGAGGATTAAAGGAGATGACCTCAT
TAGTTACTGTATTTTGTATAGCGATGGCACTTATTTTATTTGCGATAGGGCCAGTTCT
ACGCATGCAAATAAATAAAGGGGATGTCGCTAATAAAGAGGAACTAACAAATTCATTA
GCCTCGAAATAAccattgtaagggagctgaatagctcccttttcttgtgacagtcttttgacaatgaaATG

    BCE0505 --- BCE0506


Gene: BCE0505     GI: 42779585     BI number: BCE0505     GOG: -------     Description: DNA-binding protein
Gene: BCE0506     GI: 42779586     BI number: BCE0506     GOG: -------     Description: membrane protein, putativ


  A
T  A
C  C
A  A
A  A
G  A
 GT
 AT
 GC
A  |
A  |
A  |
 TA        Ac
 AT       A  c
 AT        Ta
 TA        At
 CG        At
 GC       |  g
|  C      |  t
|  T      A  a
|  C      G  a       aa
 CG        Cg       g  t
 TA        Tg        ta
G  A       Cg        cg
 TA       |  a       gc
 AT        Cg        at
G  A       Gc        gc
G  A       At        gc
 Gc        Tg        gc
 Gc        Ta        at
                        tttcttgtgacagtcttttgacaatgaaATG
    ..................................................................................................................