                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTTTGGTCAAGTTTCTAACTCATTCGTACGTATTGTAGATGAAGAAAAGAATGCAGA
GTTAATTCGTTACGATTTAGGAGAAGATTTCTCCATTGAAACAGCTGTTGTAGTAGGC
GAATTATACCGCCATGCAGGTGATTGGAAGTTCAATGCAATCGGAAGTGGATTCCAAG
GTGGATTAGCGTCTCTATGTAATAACTTTGGTTTAGATGTAGAGTAAtagattaatatatccatc
gatgaaatgcatgtttactgatggatatattttttagataaaaatatagaggtgaatataaATG

    BCE0515 Gene: BCE0515     GI: 42779595     BI number: BCE0515     GOG: COG2310     Description: tellurium resistance protei            ag           t  a            At         c            At       g  a            Ta       t  t           G  a      a  g TT       A  |       at T  G      G  |       at CG        At        gt AT        Ta        ta AT        Gt       a  c T  T       Ta        gt A  A       At        cg A  G       Gc        ta TA       A  c       at GT       T  |       cg TG       T  |       cg AT        Ta        ta TA        Gt        at CG        Gc        ta TA        Tg        at CG        Ta        ta                         ttttttagataaaaatatagaggtgaatataaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [T] COG2310 Uncharacterized proteins involved in stress response, homologs of TerZ and putative cAMP-binding protein CABP1 ... can be seen here     ..................................................................................................................