                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.10 kcal/mol
Antiterminator:    Distance from promoter:33 nt. Size=58 nt.     Delta G=-16.50 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=57 nt.     Delta G= -5.97 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTCT-CATAAT. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTCTTTTGTGAATTATATCGTCATAATGGACAGTGGAAGTTTAATGCAGTAGGAAG
TGGATTCCAAGGTGGTTTAGGTGCGCTTGTAAGAGCGTATGGCTTGGATGCATAGaaag
gaaacgatattcgtttcctttttttgacctttctataaatctagcaaagaataggggatataggtaagATG

    BCE0516 Gene: BCE0516     GI: 42779596     BI number: BCE0516     GOG: COG0861     Description: tellurium resistance protein, putativ            TA           G  A   G        TG T  G       TA G  A       CG AT        GC AT        CG GC        GT GC       |  A A  A      |  T T  A      |  G G  G       TG A  |       GC CG        GT GT        AT TG        TG A  G       TG A  T       TA T  T       GT T  T      |  G T  A       GC         a G  G       TA       t  t A  G       GT       a  t A  T      |  A       gc G  G      |  G       cg GC       G  a       at TG       A  a       at GC       A  a       at |  T       Cg        gc AT        Cg        gc CG        Ta        at AT        Ta        at                         tttttgacctttctataaatctagcaaagaataggggatataggtaagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0861 Membrane protein TerC, possibly involved in tellurium resistance ... can be seen here     ..................................................................................................................