                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:106 nt.    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-16.30 kcal/mol
Antiterminator:    Distance from promoter:104 nt. Size=20 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:    Distance from promoter:57 nt.    Size=59 nt.     Delta G= -4.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TTCGTT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAATAAGCCATACATTGTTCTTCGTTATTTTAGTTGTAGCATTTGGAGCAACATT
TGTACTTCACTACGTGAAGAATTCTGGACAAGCTAAAGAAGAAGTTGCTGCTACTAAA
GAAGACAATAAATAAttgaaatgggtttgctcgttttgcgagcgcccattttttataaccaaaaatagtttataatagaagaaagactt
agaaaaagtaaatgtttttggaggtgaactgttGTG

    BCE0517 --- BCE0518 Gene: BCE0517     GI: 42779597     BI number: BCE0517     GOG: NOG12025     Description: conserved hypothetical protein Gene: BCE0518     GI: 42779598     BI number: BCE0518     GOG: COG3853     Description: tellurite resistance protein, putativ   T C  A A  A TA CG G  A TA CG |  A GC TA TA GT A  A A  A G  A A  T                  t A  A                t  t G  A                t  g At                  gc At                  cg |  g                 ta |  a                 cg |  a       tt        gc |  a      t  g      t  | |  t       gc       t  | A  g       gt        tg Tg        gc        gc Cg        tg        gc Gt        at        gc At        at        ta At        at        at Cg        gt        at                         ttttataaccaaaaatagtttataatagaagaaagacttagaaaaagtaaatgtttttggaggtgaactgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG3853 Uncharacterized protein involved in tellurite resistance ... can be seen here     ..................................................................................................................