Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:117 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -7.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTAAAAAACAAGTTTTGGAATAATAGCTTAAAGCGTTGGTTACTCGGTCCTGAAGAC
CCTAATTATGTACTAATTAAAATCAACCCCGATACAATTTATTACATCGATGGTGCCG
GTACGACGGAGCCCCAGTTTTTACGACTATAAagtgaaacaagcccccctttaggtgggcttgttttgtcgaaaag
ttcttctgaaaaaaacaataaaataggtggaactttctaaagattctgttatataatagcattaacttaaataaactgtattaaaacagattgagaggag
aaataaaaTTG

    BCE0532


Gene: BCE0532     GI: 42779612     BI number: BCE0532     GOG: -------     Description: conserved hypothetical protei


            A
          T  T
          C  A
          A  A
          G  a
           Cg
           At
          T  |
           Tg
           Ta
           Ta        tt
           Ta       t  a
 AC        Gc        cg
T  G      A  a       cg
G  A      C  a      c  t
 GC       C  |       cg
 CG       C  |       cg
 CG        Cg        cg
G  A       Gc        gc
 TG       A  c       at
 GC        Gc        at
 GC        Gc        cg
                        ttttgtcgaaaagttcttctgaaaaaaacaataaaataggtggaactttctaaagattctgttatataatagcattaacttaaataaactgtattaaaacagattgagaggagaaataaaaTTG
    ..................................................................................................................