                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:48 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -3.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATCCATTCGTACCACTTCTTGCATTAGTATTAAATGTAACAGTAATTGTTGCTATGG
CCTTTATTCCAGAACAAAGAATGGCATTGTATTGTGGTATTCCCTTTATGATTGTTTG
TTTACTGTTTTACCGTGCGACAAGAAATAAGGGGAGTAACTTAGAGCATATTGAAAAG
ACAAAGACAACAGAAATAGAGAGTTTATAAtagtgattaatttggagactgtaaaattgtaaacagtctctttttttt
gtgaaaataaagctgggaacatactacgtatgcaaaggggaattagcgATG

    BCE0548 Gene: BCE0548     GI: 42779628     BI number: BCE0548     GOG: -------     Description: acetylornitine deacetylase, putativ At A  a Tg At Tg Ta T  t G  t A  a       tt G  a      a  g At       a  t Gt       a  a At       a  a Tg        ta |  g       gc A  a       ta A  g       cg A  a       at Gc        gc At        at Cg        gc At        gt             tttttttgtgaaaataaagctgggaacatactacgtatgcaaaggggaattagcgATG     ..................................................................................................................