Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:30 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.10 kcal/mol
Antiterminator: Size=77 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTTTGAAAGAAAAGGGGCTGCAGTTGTCATTCGTGATGATAGTGAGGTTTTTGCAAA
AACAGAGGCGTTATTACAAGATGATATGAAGCTTCTTCAAATGAAAGAAGCGATGAAA
AGCATTTATCGCCCAGAGCCAGCTGATCATATTGTGGATACAATTTTGGCAGAAAATC
ATGTAGAACCGAATCATATACCTATTAAATCACCTGCTCTTGCACAATCATTTACTTA
AtatgaaaccctcttttgtatgtttaaagagggttttttattgttttccaagataaagacttatccacATG

    BCE0566


Gene: BCE0566     GI: 42779646     BI number: BCE0566     GOG: -------     Description: hypothetical protei


           cc
          c  t
           ac
           at
           at
          |  t
          g  t
          t  g
          a  t
          t  a
           A
           A
           T
           T
 CT        C
T  T      A
 CG       T
 GC       T
 TA       T
|  C      A  |
C  A      C  |
C  A       T
A  T       A
C  C       A
 TA        C
 AT        A
 AT        C
 AT       G          t
 TA       T        a  g
T  C      T        t  t
A  T      C        g  t
T  T      T        t  t
C  A      C  |       ta
C  |       G        ta
A  |       T        ta
 TA        C        cg
 At       C         ta
 Ta       A         cg
 At       C  |       cg
 Cg        T        cg
 Ta        A        at
                        tttttattgttttccaagataaagacttatccacATG


    ..................................................................................................................