Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:179 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G=-12.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGAGCTTTTTTAGAGAAGAATCAGGAGAGAAAATGGCATAAcccctttttaaggggttattttttt
gtaaactttttatttttttagttgacaatgataatgaaaatcattatcatttattcgagaaatgattacattttgaattatatattttggaggagatgta
aagttaaaaagaaaataaattagatgttaatgagtggtcaacttaattggagtggtatctgttttagaaacaataactaaaaaatcatatgttaagaaat
tacaatttatataacttggaggaaagtttaaaGTG

    BCE0607


Gene: BCE0607     GI: 42779687     BI number: BCE0607     GOG: -------     Description: internalin, putativ


  t
t  t
 ta
 ta
 cg
 cg        tt
 cg       a  t
 cg       t  t
 At       t  t
 At       t  t
 Ta       t  t
 At        ta
C  |       cg
G  |       at
G  |       at
T  |      a  g
A  |       ta
A  |       gc         a
A  |       ta       a  a
A  |       ta       a  t
G  |      t  t       gc
 At       t  |       ta
 Gt       t  |       at
 At        tg        at
 Gt        ta        ta
 Gt        at        at
 At        ta        gc
 Cg        ta        ta
                        tttattcgagaaatgattacattttgaattatatattttggaggagatgtaaagttaaaaagaaaataaattagatgttaatgagtggtcaacttaattggagtggtatctgttttagaaacaataactaaaaaatcatatgttaagaaattacaatttatataacttggaggaaagtttaaaGTG


    ..................................................................................................................