                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:74 nt.    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:18 nt. Size=59 nt.     Delta G=-22.50 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-14.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tttact-tattat. It has a score value of 76.97 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tttactttttgtggaaaatagtatattatatagatatataatatatcggttatttactaggaggagcctgtcacaataggcttctcctgttcttttttag
ggggcctgtcttacaggcttttctttaaagggtaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacacataacaaaaaagggat
tgtttaagagagggggataagaaATG

    BCE0617 --- BCE0618 Gene: BCE0617     GI: 42779696     BI number: BCE0617     GOG: NOG47428     Description: conserved hypothetical protein Gene: BCE0618     GI: 42779697     BI number: BCE0618     GOG: COG2268     Description: SPFH domain/band 7 family protei ga        ac a  t      c  a ta        ta at        gt ta        ta at        cg ta        cg ta        gc at        at ta        gt at        gc ta        at gt        gc |  c       gc |  g       at |  g       tg |  t      |  t at       |  t ta       |  c at       |  t at       |  t at       |  t a  a      |  t gc       c  t gt        at ta        ta         t g  g       tg       c  t tg        tg       t  a ta       a  g       gc tg       t  g       ta tg        tg        cg ta        gc        cg cg        gc        gc                         ttttctttaaagggtaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacacataacaaaaaagggattgtttaagagagggggataagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2268 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:126 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-21.10 kcal/mol                                                                         Nomenclature/Definitions ATGTATATAAATATGATAATGGCGATGGAACTTACGAATTATCAGTAAAATAAgtgctttt ccaatgtatgtttaactttactttttgtggaaaatagtatattatatagatatataatatatcggttatttactaggaggagcctgtcacaataggcttc tcctgttcttttttagggggcctgtcttacaggcttttctttaaagggtaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacac ataacaaaaaagggattgtttaagagagggggataagaaATG     BCE0617 --- BCE0618 Gene: BCE0617     GI: 42779696     BI number: BCE0617     GOG: NOG47428     Description: conserved hypothetical protein Gene: BCE0618     GI: 42779697     BI number: BCE0618     GOG: COG2268     Description: SPFH domain/band 7 family protei           ac          c  a           ta           gt           ta           cg           cg           gc           at           gt           gc           at           gc           gc           at           tg             ttcttttttagggggcctgtcttacaggcttttctttaaagggtaaataactgaaaattaagaacaataatctttgaaagaggtggggcatacacataacaaaaaagggattgtttaagagagggggataagaaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2268 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................