Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-10.41 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGGGAAAAATTAATGATGATCCGAAAAAATAACGGTGAACTTGAAAAGGTTGCAGTC
GGCATCAGTGGAAATATAAGATTAGTAAATGTAGTTGTTGGGCAGCAAATTCATACAG
GTACATTATTAGTTAGGTTGGAAGATGATTTATTAATTACAGGTTGTGAATGAtgagaggt
gtgtagagaggactacacatcttttttgttccatatattacaaaagacacatcgttttttcacaaatcgcacacaagtttttgatatgctccttgtagaa
gatacggttagggaggaaatataATG

    BCE0624


Gene: BCE0624     GI: 42779703     BI number: BCE0624     GOG: -------     Description: lipoprotein, putativ


            T
          T  T
          A  A
          G  T
          T  T
          A  A
          G  A
          A  T
          A  T
          G  A
           GC
           TA
  C        TG
G  A      G  G
A  A       GT
C  A       AT
 GT        TG
 GT       T  T
 GC       G  G
 TA       A  |
|  T       TA
 TA        TA
 GC        AT        ag
 TA        TG       g  g
 TG        TA       a  a
G  G       At        gc
 AT        Cg        at
 TA       A  a       ta
 GC       T  g       gc
 TA       G  a       ta
A  |      G  g       gc
 AT       A  |       ta
 AT        Cg        gt
 TA        At        gc
 GT        Tg        at
 AT        At        gt
 TA        Cg        at
                        tttgttccatatattacaaaagacacatcgttttttcacaaatcgcacacaagtttttgatatgctccttgtagaagatacggttagggaggaaatataATG


    ..................................................................................................................