                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:184 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.30 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAAAATATTAGTAGAGAGCAGATGGGGAGAGGGTACTTGTTTTGAAGTGATTCTTCC
GAAAAACCAAAGGATATAAgtgagaagacgatcttgtttttacaaggtcgtctttttttaagggaaagttaagaaactatttttaa
catgtattatatacgtaaagttcgccctataaagaagcgattataaaaaggtatttgagtagattacatcgatcataatatagtattaaaattttatggg
aatgatggaaaagaaagtgtaagagggaggaattaattttgaaaaagaaaatgatgATG

    BCE0636 Gene: BCE0636     GI: 42779715     BI number: BCE0636     GOG: -------     Description: hypothetical protei ga a  a g  g ta gc A  g A  | T  | A  |       tt Ta       t  t At        ta Gc        gc Gt        ta At        ta A  |       cg A  |       tg C  |       at Cg        gc At        cg At        at At        gc At        at At        at             tttttaagggaaagttaagaaactatttttaacatgtattatatacgtaaagttcgccctataaagaagcgattataaaaaggtatttgagtagattacatcgatcataatatagtattaaaattttatgggaatgatggaaaagaaagtgtaagagggaggaattaattttgaaaaagaaaatgatgATG     ..................................................................................................................