                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACAGAAACAAGCATTTTATCTAGTATTGAACCACTTGTAGCTGCCATCGTTTCAAT
CGCTTGGCTGAATGAATCTTTTGGAGCATATCAATTATTAGGCGGCGTATGTATCGTT
CTTTCTGTTATTTTCTTAACAATGCCGCAAAAAGAAAATGAGCCAGCCTTTACATCTG
AACAAATATAGaaaatgtcaaaaaaggtcgtacaaaacttacgacctctttttatactttaaaggaattgtcccgctttctagcaaatacaa
ttacactaacaatcaaaattaggagtgtggcaccATG

    BCE0644 Gene: BCE0644     GI: 42779722     BI number: BCE0644     GOG: -------     Description: lipoprotein, putativ AA C  A A  T A  A GT TA CG Ta |  a |  a |  a At Cg         a At       a  a |  c      a  c |  a      c  t |  a       at |  a       ta Ta        gc Ta        cg Ta        ta Cg        gc Cg        gc Gt        at             ctttttatactttaaaggaattgtcccgctttctagcaaatacaattacactaacaatcaaaattaggagtgtggcaccATG     ..................................................................................................................