Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:155 nt.    Distance to gene:16 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=34 nt.     Delta G= -3.14 kcal/mol
Anti-antiterminator:    Distance from promoter:87 nt.    Size=51 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTAAAA-TAGTAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAAAAAATCAATTGAGGATACATTAGTATGCTGAAATAGCCACTGAATCATTGGACC
AGATAATCCCCATAATGTAGCTCCTGTAATAATCATAATGAGTCCGATACGTCTACCA
TTGTTCATtatcatgtttctcctctctggtatttgattttttatgtgtgacatgataaaaggaattatatataacttctggtactgtaaaaagt
atcagattgtagttttattaaggggtcagatattATG

    BCE0646


Gene: BCE0646     GI: 42779724     BI number: BCE0646     GOG: -------     Description: transcriptional regulator, GntR famil


  t
c  c
t  t
 cg
 cg
|  t
|  a
|  t
|  t
t  t
 cg
 ta
|  t                 aa
|  t                t  a
|  t       aa       g  a
t  t      t  a       ta
t  t      a  a       cg
 gt       g  g       at
 ta       t  g       ta
 at       a  a       gt
 cg       c  a       gc
t  t       at        ta
a  |       gt        cg
t  |       ta        ta
 Tg        gt       t  |
 At        ta       c  |
 Cg        gt        at
T  |       ta        at
 Ta        at        tg
 Gc        ta        at
 Ta        ta        ta
                        gttttattaaggggtcagatattATG


    ..................................................................................................................