                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:194 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-21.00 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -5.50 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGTTCGCAGGATAATTTAGAACAAGCTAATTAAaagcttagttaaaagggatataagtatagtaagccttG
TGCGTCTAGGGAACGCGCAAGGCTTTTTCTTTTGTGCAAAGTGTATATTCTTTTTGTA
TGAGAATGTAATGGATGCGGAAAATATGTGTAGATCTTTTTAAaatgtgaacgaaatgttcaaaaaaa
tgtatgagatttcattgacacatatgaatggacgctcatataataaaggtataagatatatgaatgattgttcatatgttcaaataaagaggtgagctat
aATG

    BCE0662 --- BCE0663 Gene: BCE0662     GI: 42779740     BI number: BCE0662     GOG: COG0640     Description: transcriptional regulator, ArsR family Gene: BCE0663     GI: 42779741     BI number: BCE0663     GOG: -------     Description: heavy metal-transporting ATPas   T T  A A  A A  a Ta         t Cg       g  a Gc       a  t At       a  a At        tg |  a       at Cg        ta At       a  a       AG At       g  g      T  G G  a       gc        CG A  a       gc        TA Ta        at       |  A Ta        at        GC Tg       |  G       CG A  g      |  T       GC A  g      a  G       TG Ta       a  C       GC At       t  G       tA |  a      t  T       tA G  t       gC        cG G  a       aT        cG A  a       tA        gC Cg        tG        aT Gt        cG        aT                         TTTCTTTTGTGCAAAGTGTATATTCTTTTTGTATGAGAATGTAATGGATGCGGAAAATATGTGTAGATCTTTTTAAaatgtgaacgaaatgttcaaaaaaatgtatgagatttcattgacacatatgaatggacgctcatataataaaggtataagatatatgaatgattgttcatatgttcaaataaagaggtgagctataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in B_cereus_ATCC_10987                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:201 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-15.10 kcal/mol Antiterminator: Size=45 nt.     Delta G= -5.50 kcal/mol Anti-antiterminator:   Size=45 nt.     Delta G= -4.54 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GAAGTTCGCAGGATAATTTAGAACAAGCTAATTAAaagcttagttaaaagggatataagtatagtaagccttG TGCGTCTAGGGAACGCGCAAGGCTTTTTCTTTTGTGCAAAGTGTATATTCTTTTTGTA TGAGAATGTAATGGATGCGGAAAATATGTGTAGATCTTTTTAAaatgtgaacgaaatgttcaaaaaaa tgtatgagatttcattgacacatatgaatggacgctcatataataaaggtataagatatatgaatgattgttcatatgttcaaataaagaggtgagctat aATG     BCE0662 --- BCE0663 Gene: BCE0662     GI: 42779740     BI number: BCE0662     GOG: COG0640     Description: transcriptional regulator, ArsR family Gene: BCE0663     GI: 42779741     BI number: BCE0663     GOG: -------     Description: heavy metal-transporting ATPas   T         a A  G      t  t a  A      a  a t  A      g  a a  a       gg ta        gt cg        aa gc       a  t at       a  a gt        ag ta        tt        AG g  g       ta       T  G gt        ga        CG at       |  g       TA g  a      |  c      |  A a  a      a  c       GC a  a      t  t       CG a  a      t  t       GC t  g      c  G       TG a  g       gT        GC a  |       aG        tA a  |       aC        tA cg        AG        cG ta        AT        cG                         CTTTTTCTTTTGTGCAAAGTGTATATTCTTTTTGTATGAGAATGTAATGGATGCGGAAAATATGTGTAGATCTTTTTAAaatgtgaacgaaatgttcaaaaaaatgtatgagatttcattgacacatatgaatggacgctcatataataaaggtataagatatatgaatgattgttcatatgttcaaataaagaggtgagctataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0640 Predicted transcriptional regulators ... can be seen here     ..................................................................................................................