Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:54 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-25.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttcaaa-taaaac. It has a score value of 60.24 and is shown in blue

ttcaaattcctcatctatttttcataaaaccgctatttttgaccttttataaatatacccctatgtttttataattatttcccaagtttaaacacctata
aaaacaccaaataaaccctttaaataaagggtttatttggtgttttttaatttattaaaatataccccttattatacatacctaatacctatataaggta
tATG

    BCE0669 --- BCE0668


Gene: BCE0669     GI: 42779747     BI number: BCE0669     GOG: -------     Description: hypothetical protein
Gene: BCE0668     GI: 42779746     BI number: BCE0668     GOG: -------     Description: membrane protein, putativ


          aa
         a  t
          ta
          ta
          ta
          cg
          cg
          cg
          at
          at
          at
          ta
          at
          at
          at
          cg
          cg
          at
          cg
          at
            tttttaatttattaaaatataccccttattatacatacctaatacctatataaggtatATG
    ..................................................................................................................