                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATTAAACGAAGAACAAGGAAACGTCGTTGCCAGATTTGGCCTTAAATTACTATACGG
AGCAACTCTCGTTAGCATTTTATCTGCAATTATCGTAAGCATTATGTTGTAAttaggtaaa
attttatcattttcttctccctatcttttgtatacaataacgaatagatgtctttataaataatcaagacatctattttttatacatgtacaatcgcttt
tatttagcgtacaatattttttatgtgtttgaatgcgcttctagatgtatatactttgatagttttaaaggagaaaaaatgATG

    BCE0673 Gene: BCE0673     GI: 42779751     BI number: BCE0673     GOG: -------     Description: transcription antiterminator, LytR famil             a           a  t           a  a ca        ta a  a       at t  t      t  c a  a       ta ta        ta gc        cg tg        ta ta        gc ta        ta |  t       at ta        gc cg        at ta        ta at        at tg        at             ttttatacatgtacaatcgcttttatttagcgtacaatattttttatgtgtttgaatgcgcttctagatgtatatactttgatagttttaaaggagaaaaaatgATG     ..................................................................................................................