                                                                        Gene putatively regulated by attenuation in B_cereus_ATCC_10987

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:68 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=64 nt.     Delta G=-11.20 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGAACATGTAACGTAACACAATTACAGGAAGTGTTAGAAATTCCGCAATCAACAGTTT
CGCAACATTTAACGAAATTAAAACAAAATAAAGTAGTACGCTTTGAACGACGAGGACT
GGAAGTGTATTATCAAATTCATAATGATAAAGTAAGTGAAGTAGTAAAAACATTATTT
TCTTAAaatttgaatattatggaaaaagacgtatgggatctacgtctttttttatttgttagaaggtgatatgagaaagaatgttaatatgtaagg
aaaaaaggctaaccattaaaatgttgctatATG

    BCE0681 Gene: BCE0681     GI: 42779759     BI number: BCE0681     GOG: -------     Description: conserved hypothetical protei            AA           A  A           A  C            TA            GT   C        AT T  A       TA T  T       GT A  A       AT A  A       AT AT        GT CG       T  | TA        GC AT        AT TA        AT TA        TA A  A      |  A        g T  G      |  a      g  a GT       G  a      g  t TA        At       t  c G  A       At        at A  G       At        ta A  T       Tg        gc G  G      |  a       cg G  A      A  a       at TA        Gt        gc CG        Ta        at AT        At        at G  A       At        at G  |       Ta        at A  |       At        at G  |       Cg        gt CG        Tg        gt AT        Ta        ta                         tttgttagaaggtgatatgagaaagaatgttaatatgtaaggaaaaaaggctaaccattaaaatgttgctatATG     ..................................................................................................................