Gene putatively regulated by attenuation in B_cereus_ATCC_10987
Characteristics of the secondary structures
Terminator: Distance to gene:78 nt. Distance to run of Ts=0 nt. Size=27 nt. Delta G= -7.80 kcal/mol
Antiterminator: Size=43 nt. Delta G= -6.30 kcal/mol
Anti-antiterminator: Size=44 nt. Delta G= -8.59 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ATGGAAAAAAGCATCTAACGCTAATTTCCAACTCGTATTTGTATATCCAAAAATAATA
CTTCCCCAAATACAAGTAATGACTGCAATGATCCCAACAAATAATCCAATCCATTTTG
CTTGATTTGTTTTTAATAACATgcagcgtttccccttcaatgtataatgatacgttgtaagtgtatttcaacttaattctcatt
gtcaacggaaatgagaattattttcattgacaacgaggccatgaagtattattatcatgcttgctattgaaaaaaattctcactatgtagggggtacata
ATG
BCE0683
Gene: BCE0683 GI: 42779761 BI number: BCE0683 GOG: ------- Description: iron compound ABC transporter, iron compound-binding protei
tt
at a t
a g t c
c t g a
t a ta
t t gc
c a at
c a at
c t ta
cg g a ac
ta t t a g
t t t t cg
ta g c ta
gc c | g |
cg a | ta
gt t | ta
at at at
cg gc cg
gt ta ta
Ta at cg
A a at ta
Cg tg ta
At at at
tattttcattgacaacgaggccatgaagtattattatcatgcttgctattgaaaaaaattctcactatgtagggggtacataATG
..................................................................................................................